Tag Archives: evolution
Video

The Improbability of You: Meiosis Part One

31 Jul

In this video, we talk about how improbable it is that you exist, the durability of genetic information across time, your relatedness to all living this on earth, and your uniqueness. These concepts will lay the foundation for explaining meiosis — the cellular dance that makes you a mosaic of your ancestors who is different from everyone else, even your siblings.

Eternity in a grain of gene

16 Jun

Our genetic cousin, the aye-aye. Photo by Flickr user JLplusAL.

From the Lion’s Mane Jellyfish of the Arctic to the goblin-faced Aye-aye of Madagascar, the variation of life on our planet is astonishing.

This diversity is still more bewildering when we consider that we, all living things, are encoded by the same four nucleic acid bases:  Adenine (A), Thymine (T), Cytosine (C) and Guanine (G).

The first 50 bases of Chromosome 1 of the chicken: AAATCCCACCATCCAGTGTACCCTTTCCTCATGGGTTTTTAATATTTTAG.

And now, the lizard:

GTGTATTCGAATGATATAAACAATAGAAATAAGCAGTAGAAAACATTTGA.

Consider this sentence, written in binary code:

01000101 01110110 01100101 01101110 00100000 01110100 01101000 01101111 01110101 01100111 01101000 00100000 01111001 01101111 01110101 00100000 01101111 01101110 01101100 01111001 00100000 01101000 01100001 01110110 01100101 00100000 01110100 01110111 01101111 00100000 00100010 01101100 01100101 01110100 01110100 01100101 01110010 01110011 00100010 00100000 00101000 01110100 01101000 01100001 01110100 00100000 01100001 01110010 01100101 00100000 01100001 01100011 01110100 01110101 01100001 01101100 01101100 01111001 00100000 01101110 01110101 01101101 01100010 01100101 01110010 01110011 00101001 00100000 01101001 01101110 00100000 01110100 01101000 01100101 00100000 01100010 01101001 01101110 01100001 01110010 01111001 00100000 01100001 01101100 01110000 01101000 01100001 01100010 01100101 01110100 00101100 00100000 01110100 01101000 01100101 00100000 01100010 01101111 01110101 01101110 01100100 01100001 01110010 01101001 01100101 01110011 00100000 01101111 01100110 00100000 01110111 01101000 01100001 01110100 00100000 01100011 01100001 01101110 00100000 01100010 01100101 00100000 01100101 01111000 01110000 01110010 01100101 01110011 01110011 01100101 01100100 00100000 01100001 01110010 01100101 00100000 01101100 01101001 01101101 01101001 01110100 01101100 01100101 01110011 01110011 00101110.

Translation:  “Even though you only have two ‘letters’ (that are actually numbers) in the binary alphabet, the boundaries of what can be expressed are limitless.”

The four-letter alphabets of DNA and RNA have “written” everything that ever lived on our planet.

[Thanks to: the Genome Bioinformatics Group of UC Santa Cruz’s “UCSC Genome Browswer” at genome.ucsc.edu.  And also to Qbit for their handy binary translator.]


Weekly reading: Your Inner Fish

16 Mar

“Carl Sagan once famously said that looking at the stars is like looking back in time.  The stars’ light began the journey to our eyes eons ago, long before our world was formed.  I like to think that looking at humans is much like peering at the stars.  If you know how to look, our body becomes a time capsule that, when opened, tells of critical moments in the history of our planet and of a distant past in ancient oceans, streams and forests.  Changes in the ancient atmosphere are reflected in the molecules that allow our cells to cooperate to make bodies.  The environment of ancient streams shaped the basic anatomy of our limbs.  Our color vision and sense of smell has been molded by life in ancient forests and plains.  And the list goes on.  This history is our inheritance, one that affects our lives today and will do so in the future.”

The overarching story of Your Inner Fish is that of descent with modification.  We are modified descendents of our parents, as were they, as were their ancestors, back to the origin of life.

Neil Shubin, the paleontologist and anatomy professor who co-discovered a significant fossilized “intermediate” between fish and land-dweller, tells this story with humor and grace.  Anecdotes about particular scientists and their historic experiments infuse the whole book with a tone of enthusiastic discovery.

At first glance, parts of our bodies seem to make no sense at all.  Looking at the winding nerves in our heads, or at the circuitous route that sperm takes from scrotum to penis, our bizarre plumbing and circuitry calls to mind the wiring of an old building with new innovations added on or wound around defunct or outdated structures.  That’s exactly because the human body, 3.5 billion years in the making, was built in just that way. 

For example, Shubin tells, us, 3 percent of our entire genome is devoted to genes for detecting various odors, many of which are useless to us but may have been critical to our mammal ancestors’ survival.

Hiccups irk us, but this likely remnant from our amphibious past allows tadpoles to pump water without flooding their lungs.

Shubin tells stories about particular genes—including Sonic hedgehog that is crucial in the development of limbs, or Hox genes that control the organization of the body—which function similarly across various species, from humans to fruit flies, mice to sharks.  Various mad, Frankensteinish experiments have shown amazing results from the swapping of genes among them.

“The best road maps to human bodies lie in the bodies of other animals,” writes Shubin.  “…We are not separate from the rest of the living world; we are part of it down to our bones [and] even our genes.”

Weekly reading: The Ancestor’s Tale

27 Oct

WE– you and I– literally share a common ancestor with this unworldly creature!  And for that matter with all other life on planet Earth.

“The ravishingly beautiful Cestum veneris is one of those rare animals whose English and Latin names mean exactly the same thing, Venus’s girdle, and no wonder: the body is a long, shimmering, ethereally beautiful ribbon, too good for a goddess.” –Richard Dawkins  (Video from YouTube user quixoticknight used with permission.)

In The Ancestor’s Tale (Houghton Mifflin, 2004), Richard Dawkins guides the reader on a “pilgrimage” backward in time toward the common ancestor of all living things, which lived more than 3 billion years ago.

Tracing the evolutionary thread of humankind, the author describes 40 “rendezvous points” where humans come to share ancestors with distant cousins, from chimpanzees to eubacteria. Continue reading