The Science of Pregnancy Timeline: Week 4– How does the embryo ‘know’ what it should be shaped like?

8 Aug

Adapted from Gray's Anatomy, this surface illustration of a rabbit embryo looks just like a human's around day 13, with the central wedge forming the primitive streak (pr).

“It is not birth, marriage or death, but gastrulation, which is truly the most important time in your life.” –Biologist Lewis Wolpert

Like teens backpacking for a year before college, the immature cells of the embryo go a-travelling before they commit to becoming specific cell types like eye cells and liver cells. As it turns out, where they end up plays a huge role in what they’ll become.

In the first weeks of pregnancy, as the embryo grows from the size of a poppy seed to that of a lemon seed, its duplicating cells are moving and folding in patterns.

Image shared via Flickr by user Mammaoca2008.

If you’ve ever made a paper crane you know that you start by making creases in the paper that establish a center point, making subsequent folds perfectly symmetrical. So it is with the bodies of most all of earth’s creatures, which have two symmetrical sides. The origami analogy applies well to the early development of the embryo: The body becomes organized as layers of cells migrate, fold, and turn inward.

Around 13 days after conception, the cells of the pear-shaped embryo begin to gather at the midline, establishing the axis of the embryo called the “primitive streak.”

This development marks the beginning of “gastrulation,” (scientists again with the unsexy wordsmithing), — the establishment of the basic, 3-layered body plan.

Two weeks after fertilization, gastrulation is in full swing. (Note: most pregnancy timelines call this “week four,” since they measure from the date of the mother’s last menstrual period.)

The embryo divides into three layers:
• The outer layer will become the skin, hair, brain, nerves and spinal cord.
• The middle layer will form muscles and bones, heart and lungs, kidneys, blood vessels, testicles or ovaries.
• The inner layer will become the stuff betwixt your piehole and your corn hole, like the tongue, tonsils, and digestive system.
(For those of you taking the quiz, these are the ectoderm, mesoderm, and endoderm.)

The migrations of cells in the early embryo are critical, because cells that “know” where they are begin to behave differently, and it’s this behavior that drives development. Two ways a cell can “know” where it is: Certain signals or proteins may be more or less ample according to their location along up-and-down or front-and-back axes, making it possible for cells to “read” their location in the scheme of the body the way we read latitude and longitude lines on a map. Or, a cell “knows” its location by “communicating” with its nearest neighbors, by sending or receiving chemical signals.  Larry the skin cell working in a subcutaneous cubicle knows he is third in line for the “corner office” on the surface of the elbow, and he is waiting to move up as his predecessors retire.  And Larry himself will change as he rises in the ranks.

Cells behave differently according to where they are located:  They change shape, they attract or repel one another, they influence cells around them. Some cells self-destruct, as they do to create the space between forming fingers. A cell appropriately placed in the mesoderm, becoming part of the team that will build the heart, will begin to activate the protein-making genes that will make it a muscle cell.

Three weeks after conception (in pregnancy week 5), the embryo begins to have curves and bumps, thanks to differentiation, and is working hard to create organs. It now has muscle cells and blood cells, neurons and glial cells. The baby will be born not just with 10 fingers and 10 toes, but with some 250 cell types. These cell types, the same 250 or so that we have as adults, have identical genes. But they behave differently, and acquire distinct traits because they are expressing different genes, and thus creating different proteins, according to their placement in the body and their relationships with nearest neighbors.

Advertisements

Pregnancy timeline: 4 to 8 days after conception

5 Aug

Four days after fertilization, a wad of 16 to 32 identical cells (the berry-like “morula”) approaches the uterine cavity.

A week after fertilization, the blastocyst lands, thanks to cellular communication. Image by Tevah Platt.

But in the following day or two, it starts to look more like a dented soccer ball, with an outer ring of cells surrounding an inner cluster. Scientists have an unsexy name for this cell-wad: The blastocyst.

The geographic parsing of inner and outer cells in the blastocyst is exciting because it is the first step toward differentiation (the amazing sorting of cells into different cell types: for example, skin cells, blood cells, eye cells, etc.). The inner cells will later form the embryo, and the other cells will form the placenta.

These stem cells are the ones that are valued by researchers because they haven’t reached a point on the path of development at which they acquire super-specialized characteristics and become committed cell types like eye cells or liver cells. They are no longer “totipotent” (able to become any kind of cell); they are now “pluripotent” (able to become one of many kinds of cell in the future).

At this stage, communication across cells has ramped up with the creation of ion channels, gap junctions and protein channels– all fancy words for doors and windows through which cells can essentially chat with their neighbors.

Molecules that go in and out of these windows are the messages that circulate among the cells, allowing parts of the body to work together.

Seven or eight days after fertilization, the cells of the blastocyst also begin to coordinate with the cells in mom’s body.

For example, the blastocyst receives chemical signals from the lining of the uterus that guide them to a safe spot for landing. In turn, they secrete enzymes that clear the ground for implantation. Cellular cooperation will be critical over the next 9 months, not only for the exchange of nutrients and oxygen between mother and embryo, but for the orchestration of the embryo’s development.

We don’t often think about it, but we know from our everyday actions that our cells work together all the time. Our hands and mouths cooperate every time we eat a hunk of cheese. When Lady Gaga put on a suit made of meat, her eye cells and arm cells had to communicate with the brain cells that made that decision. Ask any person who is quadriplegic and has had his nerve cells cut off and you realize that relationships within the body run everything.

Once we have cells that can communicate, we have cells that know where they are, that can be called upon to make stuff, and that can become certain types of cells.

Safely lodged in the uterus, the ever-dividing cells can turn to the work of organizing themselves, laying out the basic plan of the body, and slowly and gently, beginning the process of differentiation that will give rise to bones and ears and knuckles.

Pregnancy timeline: One to three days after conception

4 Aug

During the first days of pregnancy, cells divide to create duplicates of the original, fertilized egg. As genes become activated, the cells begin to communicate by sending and receiving chemical signals.

Compared to cells that will later allow baby to babble and barf, the first, original cell doesn’t have much to do. Before fertilization, the egg doesn’t need a lot of protein channels, or windows and doors through which it could “chat” with its neighbors. It has only to look for one thing in its environment: The wiggly-tailed sperm. It is set up with the chemical matrix to sense sperm, to help that first wiggler to traverse into its nucleus, and to create a barrier to deflect also-rans in the sperm race.

About a day after conception, the egg divides for the first time, making an exact copy of itself.

Only now that the egg is fertilized and is making its way down the fallopian tube will it develop the chemical recognizers it will need at the end of the week to lodge into the warm wall of the uterus. Creating them any sooner would be a waste of molecular time and energy, like putting wheels on a car that might never be driven.

Making their way womb-ward, the cells that began with the egg divide every 15 hours or so. Two days after fertilization, 2 cells become 4. On day 3, 4 cells become 8.

At about the 8-cell stage, the machinery within each cell starts to click into gear and turn on. The cells have not differentiated into distinct types like eye cells or liver cells; they are at this stage still “totipotent,” or capable of becoming any type of body cell.

But now, in addition to replicating their chromosomes in order to duplicate, they begin to activate genes to create little protein machines or structural scaffolding for the cells. And they begin to produce chemicals that are communicators and recognizers– transmitters and receivers of molecular messages.

Communication between little cells will drive the development of the embryo as a whole.

Lady Gaga Revisited: How one cell becomes an entire person

3 Aug

DISCLAIMER: This latest entry has not yet been rubber stamped by the White Coats who check this blog for scientific accuracy. Corrections to lies below will come soon.  Reader comments, questions and corrections are welcome.

Months ago we began this blog by introducing a puzzle:

As if by wizardry, Lady Gaga arose from a single cell that was smaller than the period at the end of this sentence.  This ought to strike us as incredible, not only because Lada Gaga is composed of trillions of cells, but because her cells have various features and functions, so that her eye balls are distinct from her tuchus.  And yet the cells in her body, whether they make up her liver, legs or lashes, all contain the exact same DNA.

If somehow Lady Gaga had only type of cell—that is, she had grown to full size with cells that never “differentiated,” – we postulate that she would look something like the Fruit of the Loom grape man.

That is to say, she would be a blown up version of the blob she was when she was about 32-cells big, making her way toward her mother’s uterus by way of the fallopian tube.  The sac of cells at this stage is called the morula, latin for mulberry, because it looks like a cluster of seeds.

So why isn’t Lady Gaga a grape man?
Read the answer

7 ways the genome might change what you believe about the universe

28 Jul

Georgia Dunston. Photo courtesy of ©Jay Fletcher, BioMedical Faces of Science

We spoke this morning by phone with Dr. Georgia Dunston, a silver-tongued genetics professor at Howard University.

Extracting from our conversation, we present here seven ways in which Dr. Dunston says thinking about genes might impact the way we think about life.

  1. We tend to see reality as the external driving into the internal.  “Genomics shows us a picture of reality from the inside out.”
  2. The genome affects how we see ourselves. It shows us that we are all unique, but it also shows us that we are almost identical.  It also shows us that less than 2 percent of our total inheritance is involved in the making of proteins, or the making of our “flesh.”
  3. Genomics forces us to ask questions about our identity.  Who are you when you say “I’m African-American,” or, “I’m female,” or, “I’m a mother,” or “I’m the president”?  Just as our own differentiated cells are rooted in identical codes yet distinct in the paths they take, differences in humans and populations are reflections of our histories and our environments.
  4. The genome presents us with the opportunity to understand the stories of our origins, migrations and adaptations.  Human stories such as these are fundamental to our belief systems, which in turn give us purpose.
  5. Biology has come to show us that bodies are huge systems of parts that work together.  “The genome unfolds and reveals for us how to make a body in exquisite detail.”  Now that we know the structure of the genome, we are working now to understand how genes function.  But epigenetics (which studies how genes are regulated) has shown us that you can’t know this outside of the context of the body acting in its environment.   Our beliefs, our minds, and our behaviors all impact our bodies at the physical level.  “The genome is governed by what you believe life is.”
  6. Genomics has shown us that the story of our genes is not the story of disease, death and dying.  It is the story of health.  It’s the story of life.
  7. Through genomics we see that as humans we may be only tadpoles in the scheme of a larger process.  We see that we are nested in something larger than ourselves: Life.  You came from it. You can’t define it.  You can’t get out of it.  You are in it.  And life is unlimited.

Stayin alive

27 Jul

A hungry macrophlage eats an invader.  Sound effects added!  YouTube video credited to the School of Molecular and Cellular Biology University of Illinois at Urbana-Champaign.

Death typically happens to us just the once.  But our cells, which, in a way, are us, die all the time, literally billions of times every day.

Cellular death can be great for us. When we developed as embryos, our hands were “sculpted” by self-destructing cells that forged by their disappearance the space we see between our fingers.  Throughout our lives, patrolling cells in our bloodstream constantly look out for weak, feeble, infected and mutated cells that aren’t functioning, could contaminate other cells and would be best recycled.

But cells also die as the result of abuse, trauma, or disease, and in this context these mini-deaths at the cellular level begin to build up the potential for the big D at the body level.

Which deaths to avoid

How we die

25 Jul

The shiny dots at the ends of these chromosomes are telomeres, the shortening "bomb fuses" that give cells expiration dates. Photo from the U.S. Department of Energy Human Genome Program

All roads lead to death, and we should all hope to take the scenic route.

                Some of us will pickle ourselves: We can smoke, drink, and burger our ways into Heaven.  Some of us will arrive instantaneously, let’s say, while texting.  But most of us will approach death along some kind of BINGO model.  One example:

                B: We’ve got atherosclerosis, or clogged arteries.

                I: We were born with something, like a propensity for high cholesterol.

                N: We have high blood sugar levels; G: We’re not exercising;  O: That one last cigar.

You’re expected to live about 48 million minutes: You’ve got time to read on!

We could learn a lot from an embryo.

28 Jun

Photo by Yorgos Nikas, Wellcome Images, images@wellcome.ac.uk, shared via Flickr.

The lesson of the embryo: The steps we take toward becoming something magnificent may, along the way, look decidedly un-magnificent. In the moment, we look nothing like what we are becoming.

Growing in the womb we look primitive, unusual, and grotesque. We look like turds, bean sprouts, aliens, fish.

We may look like (or be) a clumsy teenager before we emerge as artists and athletes.

It is the patience of watching improbable pieces come together that gives us the ability to build planes or go to the moon, to sculpt masterpieces or to make dinner.

Eternity in a grain of gene

16 Jun

Our genetic cousin, the aye-aye. Photo by Flickr user JLplusAL.

From the Lion’s Mane Jellyfish of the Arctic to the goblin-faced Aye-aye of Madagascar, the variation of life on our planet is astonishing.

This diversity is still more bewildering when we consider that we, all living things, are encoded by the same four nucleic acid bases:  Adenine (A), Thymine (T), Cytosine (C) and Guanine (G).

The first 50 bases of Chromosome 1 of the chicken: AAATCCCACCATCCAGTGTACCCTTTCCTCATGGGTTTTTAATATTTTAG.

And now, the lizard:

GTGTATTCGAATGATATAAACAATAGAAATAAGCAGTAGAAAACATTTGA.

Consider this sentence, written in binary code:

01000101 01110110 01100101 01101110 00100000 01110100 01101000 01101111 01110101 01100111 01101000 00100000 01111001 01101111 01110101 00100000 01101111 01101110 01101100 01111001 00100000 01101000 01100001 01110110 01100101 00100000 01110100 01110111 01101111 00100000 00100010 01101100 01100101 01110100 01110100 01100101 01110010 01110011 00100010 00100000 00101000 01110100 01101000 01100001 01110100 00100000 01100001 01110010 01100101 00100000 01100001 01100011 01110100 01110101 01100001 01101100 01101100 01111001 00100000 01101110 01110101 01101101 01100010 01100101 01110010 01110011 00101001 00100000 01101001 01101110 00100000 01110100 01101000 01100101 00100000 01100010 01101001 01101110 01100001 01110010 01111001 00100000 01100001 01101100 01110000 01101000 01100001 01100010 01100101 01110100 00101100 00100000 01110100 01101000 01100101 00100000 01100010 01101111 01110101 01101110 01100100 01100001 01110010 01101001 01100101 01110011 00100000 01101111 01100110 00100000 01110111 01101000 01100001 01110100 00100000 01100011 01100001 01101110 00100000 01100010 01100101 00100000 01100101 01111000 01110000 01110010 01100101 01110011 01110011 01100101 01100100 00100000 01100001 01110010 01100101 00100000 01101100 01101001 01101101 01101001 01110100 01101100 01100101 01110011 01110011 00101110.

Translation:  “Even though you only have two ‘letters’ (that are actually numbers) in the binary alphabet, the boundaries of what can be expressed are limitless.”

The four-letter alphabets of DNA and RNA have “written” everything that ever lived on our planet.

[Thanks to: the Genome Bioinformatics Group of UC Santa Cruz’s “UCSC Genome Browswer” at genome.ucsc.edu.  And also to Qbit for their handy binary translator.]


What’s inside us? Busy, busy towns.

7 Jun

The illustrators of biology textbooks have created countless diagrams to help students label and memorize our parts.  The pictures are useful and elegant, but they don’t tell us much about how our parts go.

Better for this than an anatomist’s best illustration of an animal cell is the cover of Richard Scarry’s “Busy, Busy Town.”

See the town!

Cheat Sheet: Dominance

25 Apr

The term “dominant” refers to the relationship between the two versions of a gene (more accurately, alleles) we inherit from each parent for the same trait.

For example, we all have two alleles that determine thumb-shape, one from mom, one from dad.  As it happens, we only need one of these alleles to code for straight thumbs in order to be born with straight thumbs.  Therefore this trait is said to be dominant, and the alternative, curvy thumbs, is said to be “recessive.”

It’s common to abbreviate dominant traits with a capital letter, and recessive ones in lower case.  For example, S=straight thumbs, and  c=curvy thumbs.  In this example, the combinations SS or Sc would give a person straight thumbs.  Only cc would result in “hitchhiker’s thumb,” the recessive trait where the thumbs curve backward in the upright, “thumbs up” position.

Ben Stiller has hitchhiker’s thumb, so he must have “curvy” thumb-shape alleles from both parents (cc).

Note that Anne Meara and Jerry Stiller could actually have straight thumbs and yet be carriers who were capable of passing along the “c” trait to Ben, if the alleles they got from their parents were, in both cases, S and c.  In this scenario, Ben Stiller would have had a 1 in 4 chance of inheriting the cc combination from his parents.

The “father of genetics” Gregor Mendel was the first to describe dominance when his experiments with pea plants showed pretty consistently that recessive traits like short, green or wrinkled appeared 1 in 4 times among the offspring of cross-bred plants.

Weekly reading: Your Inner Fish

16 Mar

“Carl Sagan once famously said that looking at the stars is like looking back in time.  The stars’ light began the journey to our eyes eons ago, long before our world was formed.  I like to think that looking at humans is much like peering at the stars.  If you know how to look, our body becomes a time capsule that, when opened, tells of critical moments in the history of our planet and of a distant past in ancient oceans, streams and forests.  Changes in the ancient atmosphere are reflected in the molecules that allow our cells to cooperate to make bodies.  The environment of ancient streams shaped the basic anatomy of our limbs.  Our color vision and sense of smell has been molded by life in ancient forests and plains.  And the list goes on.  This history is our inheritance, one that affects our lives today and will do so in the future.”

The overarching story of Your Inner Fish is that of descent with modification.  We are modified descendents of our parents, as were they, as were their ancestors, back to the origin of life.

Neil Shubin, the paleontologist and anatomy professor who co-discovered a significant fossilized “intermediate” between fish and land-dweller, tells this story with humor and grace.  Anecdotes about particular scientists and their historic experiments infuse the whole book with a tone of enthusiastic discovery.

At first glance, parts of our bodies seem to make no sense at all.  Looking at the winding nerves in our heads, or at the circuitous route that sperm takes from scrotum to penis, our bizarre plumbing and circuitry calls to mind the wiring of an old building with new innovations added on or wound around defunct or outdated structures.  That’s exactly because the human body, 3.5 billion years in the making, was built in just that way. 

For example, Shubin tells, us, 3 percent of our entire genome is devoted to genes for detecting various odors, many of which are useless to us but may have been critical to our mammal ancestors’ survival.

Hiccups irk us, but this likely remnant from our amphibious past allows tadpoles to pump water without flooding their lungs.

Shubin tells stories about particular genes—including Sonic hedgehog that is crucial in the development of limbs, or Hox genes that control the organization of the body—which function similarly across various species, from humans to fruit flies, mice to sharks.  Various mad, Frankensteinish experiments have shown amazing results from the swapping of genes among them.

“The best road maps to human bodies lie in the bodies of other animals,” writes Shubin.  “…We are not separate from the rest of the living world; we are part of it down to our bones [and] even our genes.”