Archive | Your genes RSS feed for this section

GeneDoe Hiatus

9 Nov

Due to genetics-related circumstances– the birth of baby Willa on Oct. 23– we will be taking a short hiatus from posting to GeneDoe.  Browse through our older posts and return for new entries before the new year.

In the meantime, take a look at Willa’s karyotype— and check out her phenotype!  What a cutie.

 

karyotype

Willa's karyotype

Advertisements

Body building: step one

26 Aug

All animals begin as a ball of cells and emerge as amazing sculptures.

The body-building process begins with gastrulation:  In most cases, an indentation in the cell ball produces an opening that will eventually become the anus.  Cells migrate to form the three basic layers of the body, and they establish the primary axes that determine the right/left and front/back sides of the animal.  Once they’ve been organized like little subgroups at a conference, interactions among appropriate cells initiate the process of organ creation.

In this video we can actually watch the gastrulation process unfolding in the blastula (cell ball) that will become a little white frog.

Nurture begins in the womb

25 Aug
Epigenetics is the study of the chemical reactions that govern which genes get turned on or off. Wikipedia image credited to the National Institutes of Health (NIH).

Am I hungry? Have I just gotten sloshed? Am I in outer space?

All of these factors affect how I am feeling, and less obviously, how my genes are functioning.

If I am a pregnant lady, factors like these become critical because they impact the activation and silencing of genes that coordinate the delicate orchestration of my baby’s development.

Remember, genes are the same in all of our cells, but our cells and body parts look and behave differently because certain genes within them are switched on or off. And in order for the cells of a developing embryo to emerge is a person, genes need to be switched on and off at just the right moment.

What’s controlling these switches? It’s not the genes themselves. Epigenetic signals –(click this for great videos and articles on epigenetics from the University of Utah’s Genetic Science Learning Center) –are the conductors that cue genes in and out at just the right time. They change in function of what we eat, smoke, breathe and drink. _Read on

Lady Gaga Revisited: How one cell becomes an entire person

3 Aug

DISCLAIMER: This latest entry has not yet been rubber stamped by the White Coats who check this blog for scientific accuracy. Corrections to lies below will come soon.  Reader comments, questions and corrections are welcome.

Months ago we began this blog by introducing a puzzle:

As if by wizardry, Lady Gaga arose from a single cell that was smaller than the period at the end of this sentence.  This ought to strike us as incredible, not only because Lada Gaga is composed of trillions of cells, but because her cells have various features and functions, so that her eye balls are distinct from her tuchus.  And yet the cells in her body, whether they make up her liver, legs or lashes, all contain the exact same DNA.

If somehow Lady Gaga had only type of cell—that is, she had grown to full size with cells that never “differentiated,” – we postulate that she would look something like the Fruit of the Loom grape man.

That is to say, she would be a blown up version of the blob she was when she was about 32-cells big, making her way toward her mother’s uterus by way of the fallopian tube.  The sac of cells at this stage is called the morula, latin for mulberry, because it looks like a cluster of seeds.

So why isn’t Lady Gaga a grape man?
Read the answer

7 ways the genome might change what you believe about the universe

28 Jul

Georgia Dunston. Photo courtesy of ©Jay Fletcher, BioMedical Faces of Science

We spoke this morning by phone with Dr. Georgia Dunston, a silver-tongued genetics professor at Howard University.

Extracting from our conversation, we present here seven ways in which Dr. Dunston says thinking about genes might impact the way we think about life.

  1. We tend to see reality as the external driving into the internal.  “Genomics shows us a picture of reality from the inside out.”
  2. The genome affects how we see ourselves. It shows us that we are all unique, but it also shows us that we are almost identical.  It also shows us that less than 2 percent of our total inheritance is involved in the making of proteins, or the making of our “flesh.”
  3. Genomics forces us to ask questions about our identity.  Who are you when you say “I’m African-American,” or, “I’m female,” or, “I’m a mother,” or “I’m the president”?  Just as our own differentiated cells are rooted in identical codes yet distinct in the paths they take, differences in humans and populations are reflections of our histories and our environments.
  4. The genome presents us with the opportunity to understand the stories of our origins, migrations and adaptations.  Human stories such as these are fundamental to our belief systems, which in turn give us purpose.
  5. Biology has come to show us that bodies are huge systems of parts that work together.  “The genome unfolds and reveals for us how to make a body in exquisite detail.”  Now that we know the structure of the genome, we are working now to understand how genes function.  But epigenetics (which studies how genes are regulated) has shown us that you can’t know this outside of the context of the body acting in its environment.   Our beliefs, our minds, and our behaviors all impact our bodies at the physical level.  “The genome is governed by what you believe life is.”
  6. Genomics has shown us that the story of our genes is not the story of disease, death and dying.  It is the story of health.  It’s the story of life.
  7. Through genomics we see that as humans we may be only tadpoles in the scheme of a larger process.  We see that we are nested in something larger than ourselves: Life.  You came from it. You can’t define it.  You can’t get out of it.  You are in it.  And life is unlimited.

Stayin alive

27 Jul

A hungry macrophlage eats an invader.  Sound effects added!  YouTube video credited to the School of Molecular and Cellular Biology University of Illinois at Urbana-Champaign.

Death typically happens to us just the once.  But our cells, which, in a way, are us, die all the time, literally billions of times every day.

Cellular death can be great for us. When we developed as embryos, our hands were “sculpted” by self-destructing cells that forged by their disappearance the space we see between our fingers.  Throughout our lives, patrolling cells in our bloodstream constantly look out for weak, feeble, infected and mutated cells that aren’t functioning, could contaminate other cells and would be best recycled.

But cells also die as the result of abuse, trauma, or disease, and in this context these mini-deaths at the cellular level begin to build up the potential for the big D at the body level.

Which deaths to avoid

How we die

25 Jul

The shiny dots at the ends of these chromosomes are telomeres, the shortening "bomb fuses" that give cells expiration dates. Photo from the U.S. Department of Energy Human Genome Program

All roads lead to death, and we should all hope to take the scenic route.

                Some of us will pickle ourselves: We can smoke, drink, and burger our ways into Heaven.  Some of us will arrive instantaneously, let’s say, while texting.  But most of us will approach death along some kind of BINGO model.  One example:

                B: We’ve got atherosclerosis, or clogged arteries.

                I: We were born with something, like a propensity for high cholesterol.

                N: We have high blood sugar levels; G: We’re not exercising;  O: That one last cigar.

You’re expected to live about 48 million minutes: You’ve got time to read on!

We could learn a lot from an embryo.

28 Jun

Photo by Yorgos Nikas, Wellcome Images, images@wellcome.ac.uk, shared via Flickr.

The lesson of the embryo: The steps we take toward becoming something magnificent may, along the way, look decidedly un-magnificent. In the moment, we look nothing like what we are becoming.

Growing in the womb we look primitive, unusual, and grotesque. We look like turds, bean sprouts, aliens, fish.

We may look like (or be) a clumsy teenager before we emerge as artists and athletes.

It is the patience of watching improbable pieces come together that gives us the ability to build planes or go to the moon, to sculpt masterpieces or to make dinner.

Eternity in a grain of gene

16 Jun

Our genetic cousin, the aye-aye. Photo by Flickr user JLplusAL.

From the Lion’s Mane Jellyfish of the Arctic to the goblin-faced Aye-aye of Madagascar, the variation of life on our planet is astonishing.

This diversity is still more bewildering when we consider that we, all living things, are encoded by the same four nucleic acid bases:  Adenine (A), Thymine (T), Cytosine (C) and Guanine (G).

The first 50 bases of Chromosome 1 of the chicken: AAATCCCACCATCCAGTGTACCCTTTCCTCATGGGTTTTTAATATTTTAG.

And now, the lizard:

GTGTATTCGAATGATATAAACAATAGAAATAAGCAGTAGAAAACATTTGA.

Consider this sentence, written in binary code:

01000101 01110110 01100101 01101110 00100000 01110100 01101000 01101111 01110101 01100111 01101000 00100000 01111001 01101111 01110101 00100000 01101111 01101110 01101100 01111001 00100000 01101000 01100001 01110110 01100101 00100000 01110100 01110111 01101111 00100000 00100010 01101100 01100101 01110100 01110100 01100101 01110010 01110011 00100010 00100000 00101000 01110100 01101000 01100001 01110100 00100000 01100001 01110010 01100101 00100000 01100001 01100011 01110100 01110101 01100001 01101100 01101100 01111001 00100000 01101110 01110101 01101101 01100010 01100101 01110010 01110011 00101001 00100000 01101001 01101110 00100000 01110100 01101000 01100101 00100000 01100010 01101001 01101110 01100001 01110010 01111001 00100000 01100001 01101100 01110000 01101000 01100001 01100010 01100101 01110100 00101100 00100000 01110100 01101000 01100101 00100000 01100010 01101111 01110101 01101110 01100100 01100001 01110010 01101001 01100101 01110011 00100000 01101111 01100110 00100000 01110111 01101000 01100001 01110100 00100000 01100011 01100001 01101110 00100000 01100010 01100101 00100000 01100101 01111000 01110000 01110010 01100101 01110011 01110011 01100101 01100100 00100000 01100001 01110010 01100101 00100000 01101100 01101001 01101101 01101001 01110100 01101100 01100101 01110011 01110011 00101110.

Translation:  “Even though you only have two ‘letters’ (that are actually numbers) in the binary alphabet, the boundaries of what can be expressed are limitless.”

The four-letter alphabets of DNA and RNA have “written” everything that ever lived on our planet.

[Thanks to: the Genome Bioinformatics Group of UC Santa Cruz’s “UCSC Genome Browswer” at genome.ucsc.edu.  And also to Qbit for their handy binary translator.]


What’s inside us? Busy, busy towns.

7 Jun

The illustrators of biology textbooks have created countless diagrams to help students label and memorize our parts.  The pictures are useful and elegant, but they don’t tell us much about how our parts go.

Better for this than an anatomist’s best illustration of an animal cell is the cover of Richard Scarry’s “Busy, Busy Town.”

See the town!

Cheat Sheet: Dominance

25 Apr

The term “dominant” refers to the relationship between the two versions of a gene (more accurately, alleles) we inherit from each parent for the same trait.

For example, we all have two alleles that determine thumb-shape, one from mom, one from dad.  As it happens, we only need one of these alleles to code for straight thumbs in order to be born with straight thumbs.  Therefore this trait is said to be dominant, and the alternative, curvy thumbs, is said to be “recessive.”

It’s common to abbreviate dominant traits with a capital letter, and recessive ones in lower case.  For example, S=straight thumbs, and  c=curvy thumbs.  In this example, the combinations SS or Sc would give a person straight thumbs.  Only cc would result in “hitchhiker’s thumb,” the recessive trait where the thumbs curve backward in the upright, “thumbs up” position.

Ben Stiller has hitchhiker’s thumb, so he must have “curvy” thumb-shape alleles from both parents (cc).

Note that Anne Meara and Jerry Stiller could actually have straight thumbs and yet be carriers who were capable of passing along the “c” trait to Ben, if the alleles they got from their parents were, in both cases, S and c.  In this scenario, Ben Stiller would have had a 1 in 4 chance of inheriting the cc combination from his parents.

The “father of genetics” Gregor Mendel was the first to describe dominance when his experiments with pea plants showed pretty consistently that recessive traits like short, green or wrinkled appeared 1 in 4 times among the offspring of cross-bred plants.

How am I different from my dog?

14 Jan

Fergus smiles

It is not our differences that divide us. It is our inability to recognize, accept, and celebrate those differences.” –Audre Lorde

My dog, Fergus, is furrier than I am. He detects smells more capably, and with a wetter nose. And, this one’s a biggie, words never come out of his mouth.

But while genes help explain the diversity of life on our planet, they show us to an astonishing degree that all we living things are similar.

Gene for gene, people are said to be more than 99 percent similar, one guy to the next. Related genes in humans and apes are almost as alike. We begin to see more differences when we compare the human genome to the genomes of other animals, like dogs and mice, but not much. The related genes of mice and men are roughly 85 percent the same. Good blog. Fetch!