Eternity in a grain of gene

16 Jun

Our genetic cousin, the aye-aye. Photo by Flickr user JLplusAL.

From the Lion’s Mane Jellyfish of the Arctic to the goblin-faced Aye-aye of Madagascar, the variation of life on our planet is astonishing.

This diversity is still more bewildering when we consider that we, all living things, are encoded by the same four nucleic acid bases:  Adenine (A), Thymine (T), Cytosine (C) and Guanine (G).

The first 50 bases of Chromosome 1 of the chicken: AAATCCCACCATCCAGTGTACCCTTTCCTCATGGGTTTTTAATATTTTAG.

And now, the lizard:

GTGTATTCGAATGATATAAACAATAGAAATAAGCAGTAGAAAACATTTGA.

Consider this sentence, written in binary code:

01000101 01110110 01100101 01101110 00100000 01110100 01101000 01101111 01110101 01100111 01101000 00100000 01111001 01101111 01110101 00100000 01101111 01101110 01101100 01111001 00100000 01101000 01100001 01110110 01100101 00100000 01110100 01110111 01101111 00100000 00100010 01101100 01100101 01110100 01110100 01100101 01110010 01110011 00100010 00100000 00101000 01110100 01101000 01100001 01110100 00100000 01100001 01110010 01100101 00100000 01100001 01100011 01110100 01110101 01100001 01101100 01101100 01111001 00100000 01101110 01110101 01101101 01100010 01100101 01110010 01110011 00101001 00100000 01101001 01101110 00100000 01110100 01101000 01100101 00100000 01100010 01101001 01101110 01100001 01110010 01111001 00100000 01100001 01101100 01110000 01101000 01100001 01100010 01100101 01110100 00101100 00100000 01110100 01101000 01100101 00100000 01100010 01101111 01110101 01101110 01100100 01100001 01110010 01101001 01100101 01110011 00100000 01101111 01100110 00100000 01110111 01101000 01100001 01110100 00100000 01100011 01100001 01101110 00100000 01100010 01100101 00100000 01100101 01111000 01110000 01110010 01100101 01110011 01110011 01100101 01100100 00100000 01100001 01110010 01100101 00100000 01101100 01101001 01101101 01101001 01110100 01101100 01100101 01110011 01110011 00101110.

Translation:  “Even though you only have two ‘letters’ (that are actually numbers) in the binary alphabet, the boundaries of what can be expressed are limitless.”

The four-letter alphabets of DNA and RNA have “written” everything that ever lived on our planet.

[Thanks to: the Genome Bioinformatics Group of UC Santa Cruz’s “UCSC Genome Browswer” at genome.ucsc.edu.  And also to Qbit for their handy binary translator.]


Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s

%d bloggers like this: